guideRNA cassette for CRISPR

Found another design of a U6 gRNA cassette. One (here unnamed) company usually uses this

 

actagtgagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgNNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttgtttt

 

gRNA cassette from company

How to design CRISPR guide RNA cassettes

There aren’t any clear tools online so I wanted to create one here

 

“Cloning vector pCMV-CBA-Cas9-Rosa26gRNAs, complete sequence.” This is the file that we are looking at in Snapgene.

snapgene view CRISPR guide RNA

We find this sequence

hU6 Promoter

gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacacc

guideRNA

aaagacattaaagtctgcat

sgRNA scaffold

gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc

terminator

tttttt

In total:

gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccaaagacattaaagtctgcatgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt

 

The U6 Promoter seems to require that the first letter of the transcribed region be a G or an A. Check out the folowing paper “Mutation of nucleotides around the +1 position of type 3 polymerase III promoters: The effect on transcriptional activity and start site usage”

U6 promoter TSS

 

How to design shRNAs

Guide on how to design shRNAs according to the paper “Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells” (Paddison et al. ,2002)

Be aware, that with shRNAs you never achieve that the gene is completely off – you typically achieve a reduction of gene expression by 20-80% per shRNA. Also, standard value: you probably have to design a few shRNAs so that one might work. CRISPR just works, that’s why people love it. But CRISPR deletes the gene, so if complete knockout is lethal for the cell (organism) then shRNAs might be your better fit.

In „lower“ organsims such as nematodes and plants, genes can be silenced by RNAs that are complementary to the mRNA of the gene. Scientists found that out by just expressing long antisense (messenger) RNAs – for example if the native gene is

ATGATTAGAAAAAAAAAAA then you express the antisense RNA

TACTAATCTTTTTT (“the reverse complement”) and this binds to the RNA and prevents the ribosomes from translating proteins from the RNA template.

 

However, human cells commit apoptosis when they encounter long double-stranded RNA (antiviral protection for the organism). The silencing RNA binds to mRNA and thus blocks translation, but also other mechanisms have evolved where proteins such as Drosha produce the small silencing RNAs from a template (naturally, from a viral dsRNA). Without going any deeper into how the silencing works – highly recommended to read the paper and follow up literature – we want to do some practical work now.

So in the following, we want to design a piece of DNA that gets transcribed into shRNAs and silences a gene of interest.

In this graphic from the paper we see that easy shRNA are the most effective. No sequence mismatches are needed.

Standard length is 29 nucleotides for the shRNAs, but can be reduced to 25 bp without big losses.

In the first 5 pages of the paper, they analyse the efficiency of chemically synthesized RNAs, then they try out to have the cells produce them in vivo.

Using the CMV promoter to drive hairpins didn’t work, as the shRNAs produced would have polyA tail and 5’ cap and would be exported out of the nucleus (where the enzymes work). Also significant extensions of any strand reduced shRNA activities.

Therefore, class III promoter such as U6 can be used, they don’t produce any extensions of the RNAs.

—————————————————-

Basically this should be all the information you need to design your own shRNAs.

U6 Promoter cassette from pX330:
AGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT

U6 Promoter
spacer
CRISPR binding part of the RNA

U6 promoter will start with the first G (in the spacer) and stop at TTTTTT. CRISPR part are not needed for shRNAs.

 


 

Here a picture of how such a thing could look

snapgene shRNAs

the cells which carry this DNA will make the RNA hairpin loop, and process it into silencing RNAs loaded onto the respective silencing proteins. That’s probably  all you need to know to work with it on an abstract level

Pics of plant tissue culture, micropropagation

I noticed that there are hardly any pictures on Google Images so I thought putting these here would enrich the internet. I made them with my phone so it’s not best quality but they are free to be used anywhere

It starts as a tiny piece of the leaf that has been surface sterilized 30 secs wih Ethanol (70%) and then 3 mins in 35% dilution of houshold bleach. subsequently washed twice with autoclaved water to remove bleach. You can see how they have developed after 3 weeks

 

FAQ Genetic engineering

Theres a lot of myths about genetic engineering. Let’s have a look at them.

 

  • “Genetic modification is unnatural.” That phrase is very common. However, if you look at two apple trees in nature, their DNA will differ a bunch. During sexual breeding, roughly half of the DNA of father and half of the mother plant will be recombined. Random recombination, homologous recombination, ancient retroviruses, transposons (jumping genes) and retrotransposons will scramble up the genome. The polymerase will make copying errors such as inserting the wrong letter (ATGA->ACGA) and sometimes leave large deletions or duplications in the DNA. Also, the fact that this is natural doesn’t mean it’s harmless. Just google for the Lenape potato or the killer zucchini, natural breeding can and does produce toxic and dangerous varieties.

 

  • “But these are all natural. If humans put a gene from a fish into a tomato, that’s somehow different!” Sounds legit, right? Just in the recent years we have seen the prices for sequencing DNA drop drastically (reading DNA), and guess what we found. There’s genes from lots of different animals and plants in many different animals and plants. Google “horizontal gene transfer”, the results will blow your mind! Just to give a few examples: a fern that acquired a moss gene, butterflies that acquired wasp genes, in humans we have found more than 100 bacterial genes, … Even mammalian sperm produces reverse transcriptse and can take up RNA and DNA from its environment. In bacteria, species barriers have been known to be randomly defined by man for a long time.

 

  • “In Europe we have banned GMOs, so we have natural crops.” Nothing could be further away from the truth. As GMOs have been outlawed but “random breeding methods” are exempt from these regulations, breeders use older methods such as creating mutants by employing mutagenic chemicals and radioactive radiation. Instead of just adding one known and characterized gene, you randomly mutate hundreds of genes at the same time and pick the mutant that makes the biggest fruits. Side effects? There’s no way to tell, as no safety testing is required by law, unlike with genetically engineered plants that take 10-15 years of studies for approval which cost around 100 million dollars per plant.

 

  • “GMOs are all patented and inherently used for profit” While it is true that GMOs can (but don’t have to – check out the humanitarian open source Golden Rice) be patented, this is mainly caused by the expensive process to get them through FDA approval. You cannot sell it for 15 years, so companies patent it to make it more likely that their investment will come back with interests. Also, small Universities or entities cannot afford FDA approval processes and thus big companies like Monsanto can have big market share and less competition.

 

 

 

 

 

Small, constitutive strong plant promoter

AtTCTP Promotert2A new plant promoter. It is pretty small (0,3 kbp), but still yields 55% the expression levels of 35S. Nice for synbio applications.

From the paper: “Characterization of a small constitutive promoter from Arabidopsis translationally controlled tumor protein (AtTCTP) gene for plant transformation”.

Shown to work in Arabidopsis (dicot) and Grass (monocot).

Here a shot of the annotated file in snapgene: AtTCTP Promotert.jpg

CCCTGTTCAAAGCTATCATCGTCATTCTAGGGTTTTACACGAACAATCAGAAACAGAACGAGAAAGACGGAAGAGAAGAGAGGGAAATAGGATTTTATCCGACCCGAACACTATTTATACGTAGCCCAACACTCGAATCCCCACCCGTTGGACCAAACCCGGCTCATTAAGCGTCGGTTCAGATTTATTTCCTTTATTTAAAAAAAAGGAAAGGGTAAAAAATAGAAAATTGGAAACAGTTAAAGCCCAAAATTGTAATTTACCGAGAATTGTAAATTTACCTGAAAACCCTACGCTATAGTTTCGACTATAAATACCAAACTTAGGACCTCACTTCAGAATCCCCTCGTCGCTGCGTCTCTCTCCCGCAACCTTCGATTTTCGTTTATTCGCATCCATCGGAGAGAGAAAACAATCAATAAGCGACCATG

Effektiv spenden

Erstmal danke an alle beherzten Menschen, die die Welt besser machen wollen!

http://www.noen.at/niederoesterreich%2Fgesellschaft/spendenfreudig-oesterreicher-spenden-heuer-625-millionen-euro/31.123.240# http://www.spiegel.de/wirtschaft/soziales/spenden-deutsche-gaben-2015-so-viel-wie-nie-zuvor-a-1069812.html

Jedoch ist im heutigen postfaktischen Zeitalter Vorsicht mehr denn je angebracht. Oftmals, wenn Leute sammeln gehen (z.B: die vermeintliche „Feuerwehr“ oder das „Rote Kreuz“) sind das nicht die eigentlichen Organisationen selbst. Sondern bezahlte Firmen, die für die Feuerwehr oder das Rote Kreuz sammeln gehen. Einmalige Spenden nehmen sie gar nichtmehr, sondern nur mehr jährliche Abbuchungsaufträge. Oftmals geht dann 90% des ersten Spendenbetrages an die Firma, dann 60% des zweiten, und dann weniger. Aber jeder Euro, der an diese Keilerfirmen kommt, ist einer weniger, der den eigentlichen Organisationen hilft.

Viele Leute spenden auch unreflektiert an die großen, wie z.B. Greenpeace. Weil „die haben einen bekannten Namen und die werden schon positives machen mit dem Geld“? Denkste. Viel ihres Budgets geht dafür drauf, neue Spender zu finden.

Und dann machen sie aktivst gegen Gentechnik Stimmung. Der Gründervater von Greenpeace hat sich von Greenpeace distanziert, weil damals „ein Wissenschaftler auf einem Raum voller Aktivisten kam“. Dass Golden Rice den Vitamin A-Mangel in der dritten Welt bekämpfen könnte (Gloden Rice ist Open Source, also nicht patentiert) ist denen egal – „Gen ist Pfui“. Dass 99.999999% aller Studien sagen, dass die zugelassenen Gentechnischen Pflanzen sicher sind, interessiert sie nicht. Es wird einfach suggeriert, dass Konzerne riesen Mächte hätten und alles unter den Tisch kehren. Die Dynamik ist richtig interessant – Greenpeace stellt sich als kleiner Mann gegen die Großkonzerne da, und der Mainstream kämpfe alles für Gentechnik um uns zu vergiften. Fakt ist, Greenpeace zeigt keine Alternativen. Immer nur dagegen sein (damit lässt sich aber scheinbar eh genug Geld machen). Wissenschaftler überall auf der Welt bringen neue Gene in Pflanzen ein, um sie z.B. trockenheitsresistenter zu machen (also werden keine Pestizidresistenzen eingebaut), nur leider kann sich nur Monsanto leisten Genpflanzen zuzulassen (die regulatorischen Behörden verlangen viele Millionen Dollar, die sich kleine Unis nicht leisten können). Und Pestizidresistenzen verkaufen sich am besten. Natürlich findet man dann Spuren der eingesetzten Pestizide auf den Pflanzen (no na). Wobei die Bio-Spritzmittel oftmals noch giftiger sind (Bio Kupfersulfat ist rund 187 mal giftiger als Glyphosat – https://www.geneticliteracyproject.org/2016/05/09/popular-organic-pesticide-copper-sulfate-compare-synthetic-ones-like-glyphosate/ )

Wir könnten schon viel mehr Krankheiten heilen. Aber (größtenteils) nicht weil „Big Pharma“ die Therapien zurückhält, sondern weil Forschung chronisch unterfinanziert ist. Und weil es 15 Jahre dauert und ~1 Milliarde $ kostet, ein Medikament auf den Markt zu bringen. Auch wenn jemand im Endstadium Krebs ist und nur noch Wochen zu leben hat, wird ihm die Möglichkeit enthalten, experimentelle Therapien auszuprobieren. Hoffentlich ändern da die Regulationsbehörden bald was –momentan lähmt die Angst, dass ein Patient durch eine experimentelle Therapie zu schaden kommen könnte. Gleichzeitig sterben aber tausende an den Folgen des nicht-Eingreifens. Das ist aber eine andere Story. Zurück zum Spenden.

Lange Rede kurzer Sinn, es kann sehr hilfreich sein, zu Googlen.  Sie kennen jemanden, der Kreuzfeld-Jakob hat? Dann können sie die Forschungsgruppen direkt unterstützen – einfach Googlen. „Prion vaccine“

Google Scholar zeigt speziell wissenschaftliche Studien. https://scholar.google.at/

https://www.ncbi.nlm.nih.gov/pubmed/17234125 -> „Vaccination against prion diseases. Kalinke U1, Bach PKönig MBuchholz CJ.“ Author information: 1Divisions of Immunology and Medical Biotechnology, Paul-Ehrlich-Institut, Paul-Ehrlich-Str. 51-59, 63225 Langen, Germany. Dieses Institut forscht z.B. also gegen Prionen (KFJ beim Menschen). -> Google findet deren Seite  http://www.pei.de/EN/institute/organisation/division-6-medical-biotechnology/division-6-medical-biotechnology-node.html

Alzheimer:

https://scholar.google.at/scholar?hl=en&q=alzheimer&btnG=&as_sdt=1%2C5&as_sdtp=

Accelerated Alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor proteinand presenilin 1 transgenes

Leigh Holcomb1, Marcia N. Gordon1, Eileen McGowan2, Xin Yu2, Stan Benkovic1, Paul Jantzen1, Kristal Wright1, Irene Saad1, Ryan Mueller1, 5, Dave Morgan1, Sunny Sanders2, Cindy Zehr2, Kassandra O’Campo2, John Hardy3, Cristian-Mihail Prada4, Chris Eckman4, Steve Younkin4, Karen Hsiao5 & Karen Duff2

1Alzheimer’s Research Laboratory, Department of Pharmacology, University of South Florida, Tampa, Florida 33612, USA

2Neurotransgenics Laboratory, Mayo Clinic, Jacksonville, Florida 32224, USA email duff.karen@mayo.edu

3Neurogenetics Laboratory, Mayo Clinic, Jacksonville, Florida 32224, USA

4Molecular Neuropathology Laboratory, Mayo Clinic, Jacksonville, Florida 32224, USA

5Department of Neurology, University of Minnesota, UMHC Box 295, 420 Delaware Street, Minneapolis, Minnesota 55455, USA

Correspondence should be addressed to K.D.; e-mail duff.karen@mayo.edu.

Correspondence regarding behavior and pathology methodlogy be addressed to D.M. L.H. and M.N.G contributed equally to this work.

So kann man aktiv für Forschung spenden, die einem am Herzen liegt. Englisch ist halt Weltsprache, und es hat sich so entwickelt, dass jede wissenschaftliche Arbeit in Englisch veröffentlicht wird. Also immer nach Englischen Bezeichungen suchen (z.B. Lung Cancer = Lungenkrebs; Muscular Dystrophy; etc)

Promoters of the day – EF1a

EF1a – a „strong“ native mammalian promoter active in most or all tissues. Not as strong as viral promoters like CMV. Tends not to get silenced (like CMV does). Sometimes the EF1a core promoter with CMV enhancer is used.

Citing Invivogen “The EF-1 alpha gene encodes for elongation factor-1 alpha which is one of the most abundant proteins in eukaryotic cells and is expressed in almost all kinds of mammalian cells. The promoter of this “housekeeping” gene exhibits a strong activity, higher than viral promoters such as SV40 and RSV promoters1 , and on the contrary to the CMV promoter, yields persistent expression of the transgene in vivo2 . The rat EF-1α promoter shares a 45.05% homology to the human EF-1α promoter.” ( http://www.yrgene.com/documents/promoter/pdrive-ref1a_tds.pdf )

 

Native genomic mouse EF1a:

GGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCTCAGGGCTGAGCGCGGGGAGAGCAGAGCACACAAGCTCATAGACCCTGGTCGTGGGGGGGAGGACCGGGGAGCTGGCGCGGGGCAAACTGGGAAAGCGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGCAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGGTGAGGGGCGGGTGTGGCTTCCGCGGGCCGCCGAGCTGGAGGTCCTGCTCCGAGCGGGCCGGGCCCCGCTGTCGTCGGCGGGGATTAGCTGCGAGCATTCCCGCTTCGAGTTGCGGGCGGCGCGGGAGGCAGAGTGCGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGAGGCCTAGCGTGGTGTCCGCGCCGCCGCCGCGTGCTACTCCGGCCGCACTCTGGTCTTTTTTTTTTTTGTTGTTGTTGCCCTGCTGCCTTCGATTGCCGTTCAGCAATAGGGGCTAACAAAGGGAGGGTGCGGGGCTTGCTCGCCCGGAGCCCGGAGAGGTCATGGTTGGGGAGGAATGGAGGGACAGGAGTGGCGGCTGGGGCCCGCCCGCCTTCGGAGCACATGTCCGACGCCACCTGGATGGGGCGAGGCCTGGGGTTTTTCCCGAAGCAACCAGGCTGGGGTTAGCGTGCCGAGGCCATGTGGCCCCAGCACCCGGCACGATCTGGCTTGGCGGCGCCGCGTTGCCCTGCCTCCCTAACTAGGGTGAGGCCATCCCGTCCGGCACCAGTTGCGTGCGTGGAAAGATGGCCGCTCCCGGGCCCTGTTGCAAGGAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGGGCGGGTGAGTCACCCACACAAAGGAAGAGGGCCTGGTCCCTCACCGGCTGCTGCTTCCTGTGACCCCGTGGTCCTATCGGCCGCAATAGTCACCTCGGGCTTTTGAGCACGGCTAGTCGCGGCGGGGGGAGGGGATGTAATGGCGTTGGAGTTTGTTCACATTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTGGAAGTCATTTTTGGAATTTGTCCCCTTGAGTTTTGAGCGGAGCTAATTCTCGGGCTTCTTAGCGGTTCAAAGGTATCTTTTAAACCCTTTTTTAGGTGTTGTGAAAACCACCGCTAATTCAAAGCAAT

 

The context in which invivogen uses it in the plasmid pDRIVE-mEF1 is:

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCTCAGGGCTGAGCGCGGGGAGAGCAGAGCACACAAGCTCATAGACCCTGGTCGTGGGGGGGAGGACCGGGGAGCTGGCGCGGGGCAAACTGGGAAAGCGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGCAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGGTGAGGGGCGGGTGTGGCTTCCGCGGGCCGCCGAGCTGGAGGTCCTGCTCCGAGCGGGCCGGGCCCCGCTGTCGTCGGCGGGGATTAGCTGCGAGCATTCCCGCTTCGAGTTGCGGGCGGCGCGGGAGGCAGAGTGCGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGAGGCCTAGCGTGGTGTCCGCGCCGCCGCCGCGTGCTACTCCGGCCGCACTCTGGTCTTTTTTTTTTTTGTTGTTGTTGCCCTGCTGCCTTCGATTGCCGTTCAGCAATAGGGGCTAACAAAGGGAGGGTGCGGGGCTTGCTCGCCCGGAGCCCGGAGAGGTCATGGTTGGGGAGGAATGGAGGGACAGGAGTGGCGGCTGGGGCCCGCCCGCCTTCGGAGCACATGTCCGACGCCACCTGGATGGGGCGAGGCCTGGGGTTTTTCCCGAAGCAACCAGGCTGGGGTTAGCGTGCCGAGGCCATGTGGCCCCAGCACCCGGCACGATCTGGCTTGGCGGCGCCGCGTTGCCCTGCCTCCCTAACTAGGGTGAGGCCATCCCGTCCGGCACCAGTTGCGTGCGTGGAAAGATGGCCGCTCCCGGGCCCTGTTGCAAGGAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGGGCGGGTGAGTCACCCACACAAAGGAAGAGGGCCTGGTCCCTCACCGGCTGCTGCTTCCTGTGACCCCGTGGTCCTATCGGCCGCAATAGTCACCTCGGGCTTTTGAGCACGGCTAGTCGCGGCGGGGGGAGGGGATGTAATGGCGTTGGAGTTTGTTCACATTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTGGAAGTCATTTTTGGAATTTGTCCCCTTGAGTTTTGAGCGGAGCTAATTCTCGGGCTTCTTAGCGGTTCAAAGGTATCTTTTAAACCCTTTTTTAGGTGTTGTGAAAACCACCGCTAATTCAAAGCAATC ATG AGC GGT TCT CAT CAT CAT CAT CAT CAT GGT

With ATG being the start codon, adding a N-terminal His tag.

 

 

This *should* be the rat EF1a promoter, difficult to read from their annotation. In small letters may be the intron that each EF1a has.

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCCCAGGGCTGAGCGCGGGTAGATCAGAGCACACAAGCTCACAGTCCCCGGCGGTGGGGGGAGGGGCGCGCTGAGCGGGGGCCAGGGAGCTGGCGCGGGGCAAACTGGGAAAGTGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGTAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGgtgagtggcgggtgtggcttccgcgggccccggagctggagccctgctctgagcgggccgggctgatatgcgagtgtcgtccgcagggtttagctgtgagcattcccacttcgagtggcgggcggtgcgggggtgagagtgcgaggcctagcggcaaccccgtagcctcgcctcgtgtccggcttgaggcctagcgtggtgtccgccgccgcgtgccactccggccgcactatgcgttttttgtccttgctgccctcgattgccttccagcagcatgggctaacaaagggagggtgtggggctcactcttaaggagcccatgaagcttacgttggataggaatggaagggcaggaggggcgactggggcccgcccgccttcggagcacatgtccgacgccacctggatggggcgaggcctgtggctttccgaagcaatcgggcgtgagtttagcctacctgggccatgtggccctagcactgggcacggtctggcctggcggtgccgcgttcccttgcctcccaacaagggtgaggccgtcccgcccggcaccagttgcttgcgcggaaagatggccgctcccggggccctgttgcaaggagctcaaaatggaggacgcggcagcccggtggagcgggcgggtgagtcacccacacaaaggaagagggccttgcccctcgccggccgctgcttcctgtgaccccgtggtctatcggccgcatagtcacctcgggcttctcttgagcaccgctcgtcgcggcggggggaggggatctaatggcgttggagtttgttcacatttggtgggtggagactagtcaggccagcctggcgctggaagtcattcttggaatttgcccctttgagtttggagcgaggctaattctcaagcctcttagcggttcaaaggtattttctaaacccgtttccagGTGTTGTGAAAGCCACCGCTAATTCAAA

 

They way they use it

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCCCAGGGCTGAGCGCGGGTAGATCAGAGCACACAAGCTCACAGTCCCCGGCGGTGGGGGGAGGGGCGCGCTGAGCGGGGGCCAGGGAGCTGGCGCGGGGCAAACTGGGAAAGTGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGTAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGgtgagtggcgggtgtggcttccgcgggccccggagctggagccctgctctgagcgggccgggctgatatgcgagtgtcgtccgcagggtttagctgtgagcattcccacttcgagtggcgggcggtgcgggggtgagagtgcgaggcctagcggcaaccccgtagcctcgcctcgtgtccggcttgaggcctagcgtggtgtccgccgccgcgtgccactccggccgcactatgcgttttttgtccttgctgccctcgattgccttccagcagcatgggctaacaaagggagggtgtggggctcactcttaaggagcccatgaagcttacgttggataggaatggaagggcaggaggggcgactggggcccgcccgccttcggagcacatgtccgacgccacctggatggggcgaggcctgtggctttccgaagcaatcgggcgtgagtttagcctacctgggccatgtggccctagcactgggcacggtctggcctggcggtgccgcgttcccttgcctcccaacaagggtgaggccgtcccgcccggcaccagttgcttgcgcggaaagatggccgctcccggggccctgttgcaaggagctcaaaatggaggacgcggcagcccggtggagcgggcgggtgagtcacccacacaaaggaagagggccttgcccctcgccggccgctgcttcctgtgaccccgtggtctatcggccgcatagtcacctcgggcttctcttgagcaccgctcgtcgcggcggggggaggggatctaatggcgttggagtttgttcacatttggtgggtggagactagtcaggccagcctggcgctggaagtcattcttggaatttgcccctttgagtttggagcgaggctaattctcaagcctcttagcggttcaaaggtattttctaaacccgtttccagGTGTTGTGAAAGCCACCGCTAATTCAAAGCAACC ATG GGG GGT TCT CAT CAT CAT CAT CAT CAT

 

This is the one from chimp:

GCTCCGGTTCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGACAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGgtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccatgcccctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcttgggcgctggggccgccgcgtgctaatctggtggcaccttcgcgcctgtctcgctgctttcgctaagtctctagccatttaaaatttttgataaccagctgcgacgctttttttctggcgagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaaactggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgcccgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccttcctcatccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttgcctcattctcaagcctcagacagtggttcaaagtttttttcttccatttcagGTGTCGTGA

in context:

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGACTCGCCCCTGCCTTGGGGAATCCCAGGGACCGTCGTTAAACTCCCACTAACGTAGAACCCAGAGATCGCTGCGTTCCCGCCCCCTCACCCGCCCGCTCTCGTCATCACTGAGGTGGAGAAGAGCATGCGTGAGGCTCCGGTTCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGACAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGgtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccatgcccctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcttgggcgctggggccgccgcgtgctaatctggtggcaccttcgcgcctgtctcgctgctttcgctaagtctctagccatttaaaatttttgataaccagctgcgacgctttttttctggcgagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaaactggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgcccgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccttcctcatccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttgcctcattctcaagcctcagacagtggttcaaagtttttttcttccatttcagGTGTCGTGAAAACTACCCCTAAAAGCCACC ATG GGG GGT TCT CAT CAT CAT CAT CAT CAT

This is a EF1a core promoter plus CMV enhancer (EF1a core promoter underlined; enhancer upstream):

ACATGTTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGAATTGGTTTGATCTGATTATAACTAGTGGAGAAGAGCATGCTTGAGGGCTGAGTGCCCCTCAGTGGGCAGAGAGCACATGGCCCACAGTCCCTGAGAAGTTGGGGGGAGGGGTGGGCAATTGAACTGGTGCCTAGAGAAGGTGGGGCTTGGGTAAACTGGGAAAGTGATGTGGTGTACTGGCTCCACCTTTTTCCCCAGGGTGGGGGAGAACCATATATAAGTGCAGTAGTCTCTGTGAACATTCGCTAGCAGATCT

 

 

 

Sequence Repository

Just found this. A ribozyme that cleaves itself, unless it binds tetracyclin. Proven to work in mammalian cells.
You just have to embedd this ribozyme into a mRNA, ideally direcly after the stop codon (3’UTR). CAAA3 is used as a spacer so the ribozyme folding is more smooth, presumably because A-T binding is a lot weaker than G-C.
Seems to be very helpful when you want to use tetracycline to activate gene expression but you don’t want to introduce foreign proteins (such as the tet-transcativator that then binds a tet-operator-CMV Promoter). Without tetracycline in the medium, the mRNA cleaves itself and you get only ~25% of the expression because mRNA without a polyA tail is rapidly degraded. When you add 50 uM tet, the ribozyme is prevented from cutting itself and you get the full expression.

caaacaaacaaa
GGCGCGTCCTGGATTCGTACAAAACATACCAGATTTCGATCTGGAGAGGTGAAGAATACGACCACCTGTACATCCAGCTGATGAGTCCCAAATAGGACGAAACGCGCT
aacaaaacaaac

The ribozyme is described in the study “Conditional Control of Mammalian Gene Expression by Tetracycline-Dependent Hammerhead Ribozymes” by Kim Beilstein, Alexander Wittmann, Manuel Grez, and Beatrix Suess. I had ty type it in from the graphic, always annowing when the full sequence isn’t given in a format that’s copyable.3k4-tet-ribozyme

Alledgedly there is a better ribozyme from the study “Rational design of aptazyme riboswitches for efficient control of gene expression in mammlian cells” that has 20 fold repression wiothout tetracyclin. Unfortunately they hid their sequence very well in the paper and I have to reverse engineer all of their paper to find the sequence they used. #moretransparencyinqualityjournalsplease

 

EDIT: The author of  “Rational design of aptazyme riboswitches for efficient control of gene expression in mammlian cells” has kindly replied to my email the next day. He provided the sequences:

>TC40

GGAUCCAAACAAACAAACUGAGGUGCAGGUACAUCCAGCUGACGAGUCCCAAAUAGGACGAAAGGGAGAGGUGAAGAAUACGACCACCUAGGCUCGAAAGAGCCUAAAACAUACCUUCCUGGAUUCCACUGCUAUCCACAAAAAGAAAAAUAAAAAGAAUUC

>Theo5

GGAUCCAAACAAACAAACUGAGGUGCAGGUACAUCCAGCUGACGAGUCCCAAAUAGGACGAAAGGAAUACCAGCCGAAAGGCCCUUGGCAGUCUUCCUGGAUUCCACUGCUAUCCACAAAAAGAAAAAUAAAAAGAAUUC

Yellow/orange:aptazyme sequence

Bold underlined: communication module

Warum Biotechnologie die Grippe und den Krebs noch nicht besiegt hat

http://www.strike-the-root.com/51/walker/walker6.html

“Column by Bill Walker, posted on April 20, 2005
in

Other

I shovel telomeres for a living. My friends in the computer industry are always asking me: ‘Why can’t you biotech guys cure cancer? Or aging? Or the common cold? What do you do with all those billions of government research dollars?’

Well, it’s time to confess: Biologists bought three stuffed mice and two petri dishes in 1974. These are recycled in staged publicity photos in such high-profile popular glossies as Proceedings of the National Academy of Sciences, Cell, and Eur J Gastroenterol Hepatol. Our much-hyped ‘gene sequencing,’ ‘chromosome imaging,’ etc. are all done on Photoshop by companies in Taipei . All the rest of the money goes to yachts, scuba equipment, and private islands in Fiji for all postdocs and research associates. That’s why medical researchers always look so tanned and vigorous.

OK, seriously: If the computer industry were running under the same conditions as biotech, this is how it would work:

There would be a Federal Data Administration (FDA). Every processor, peripheral, program, printer, and power cord made in or imported into the USA would have to obtain FDA approval. This would require an average of 19 years of safety testing on lab rats and clinical trials for effectiveness on nerd volunteers with informed consent, before prescription for general human use is allowed. Any change of any kind to any chip, ergonomic keyboard, or line of code would require re-approval of the entire system and any hardware or software that could in principle be connected to it via Internet, intranet, or hand-carried disk.

In the medical system, this sort of approval can be done for only a bit over $802 million per drug or medical device (Tufts study, 2001). So it might cost only a few times more when applied to a global industry producing next-generation silicon chips. Anyway, how can anyone put a price tag on safety? Think of the children!

Today even someone who dropped out of college could legally own a large software company. To remedy this unconscionable state of affairs, state licensing boards would be created to require American Mainframe Association (AMA) membership for all computer professionals. This would ensure that all programmers go to college and postgraduate school for at least eight years, and then serve multi-year nerdships and residencies before being allowed to practice independently. Thus programmers would be fully prepared to start writing BASIC programs by age 28-30, and attain full professional status by their 40s.

These AMA professionals would prescribe for consumers the ‘right’ hardware and software (within the prescribing and cost limits of the appropriate HMO, see below). To guard against improper (‘recreational’) use of computers, all information products would now require a prescription from a professional.

A Data Enforcement Agency (DEA) would be empowered under the asset forfeiture laws to confiscate the property of smugglers and users of illegal data processing paraphernalia, such as that used in so-called ‘video games’ or ‘palm pilots.’ The DEA would also have the responsibility of ensuring that no unapproved data flows in or out of our borders.

Then the IRS would make buying computers for the home use of employees a deductible expense for employers (but not for employees), as is true of health insurance today. Companies would be forced to buy computers for their employees through Hardware Maintenance Organizations (HMOs), instead of allowing the employees to buy them directly.

Finally, the Federal government would hire hundreds of thousands of programmers and chip designers to work in government-run ‘computer research,’ controlled by NIH, the various armed services, and other fountains of innovation. Private ‘cybertech’ companies could have whoever was left over . . . if they could figure out how to con investors into funding companies which were rarely allowed to sell their products.

If we had really let government run the computer industry this way, there would be no Intel, IBM or Apple. There would be no chip industry. There would be no Internet. The NIH would be funding hundreds of labs to develop better vacuum tubes.

Now, all you programmers who are snickering at the poor dumb biologists: let me point out something. You, personally, aren’t made of doped silicon. You are made of DNA and some other junk banging around inside lipid bilayers. If you want to improve your life in any meaningful way, you need to be able to buy stuff to upgrade your DNA system.

Some organisms, like Bowhead whales, already manage to make DNA systems work for over 200 years. That means their cancer control is 1,000 times as good as ours (twice the lifespan times 500 times the cell number), and their aging control is at least twice as good. A real free-market biotech industry could pirate these already-existing DNA programs and sell them to you cheap (whales don’t get royalties, and DNA replicates as easily as chips do).

So, since you computer guys have all the money, it would behoove you to use a little of it to get rid of the FDA and all the rest of the medieval guild nonsense that encrusts the biotech industry. Then you would finally see some progress against cancer and aging.

Oh, the common cold? We could wipe out the existing varieties, but RNA and DNA hackers will always resequence new types. Viruses will always be with us; you just have to continuously update your immune system’s definitions. “