Small, constitutive strong plant promoter

AtTCTP Promotert2A new plant promoter. It is pretty small (0,3 kbp), but still yields 55% the expression levels of 35S. Nice for synbio applications.

From the paper: “Characterization of a small constitutive promoter from Arabidopsis translationally controlled tumor protein (AtTCTP) gene for plant transformation”.

Shown to work in Arabidopsis (dicot) and Grass (monocot).

Here a shot of the annotated file in snapgene: AtTCTP Promotert.jpg

CCCTGTTCAAAGCTATCATCGTCATTCTAGGGTTTTACACGAACAATCAGAAACAGAACGAGAAAGACGGAAGAGAAGAGAGGGAAATAGGATTTTATCCGACCCGAACACTATTTATACGTAGCCCAACACTCGAATCCCCACCCGTTGGACCAAACCCGGCTCATTAAGCGTCGGTTCAGATTTATTTCCTTTATTTAAAAAAAAGGAAAGGGTAAAAAATAGAAAATTGGAAACAGTTAAAGCCCAAAATTGTAATTTACCGAGAATTGTAAATTTACCTGAAAACCCTACGCTATAGTTTCGACTATAAATACCAAACTTAGGACCTCACTTCAGAATCCCCTCGTCGCTGCGTCTCTCTCCCGCAACCTTCGATTTTCGTTTATTCGCATCCATCGGAGAGAGAAAACAATCAATAAGCGACCATG

Effektiv spenden

Erstmal danke an alle beherzten Menschen, die die Welt besser machen wollen!

http://www.noen.at/niederoesterreich%2Fgesellschaft/spendenfreudig-oesterreicher-spenden-heuer-625-millionen-euro/31.123.240# http://www.spiegel.de/wirtschaft/soziales/spenden-deutsche-gaben-2015-so-viel-wie-nie-zuvor-a-1069812.html

Jedoch ist im heutigen postfaktischen Zeitalter Vorsicht mehr denn je angebracht. Oftmals, wenn Leute sammeln gehen (z.B: die vermeintliche „Feuerwehr“ oder das „Rote Kreuz“) sind das nicht die eigentlichen Organisationen selbst. Sondern bezahlte Firmen, die für die Feuerwehr oder das Rote Kreuz sammeln gehen. Einmalige Spenden nehmen sie gar nichtmehr, sondern nur mehr jährliche Abbuchungsaufträge. Oftmals geht dann 90% des ersten Spendenbetrages an die Firma, dann 60% des zweiten, und dann weniger. Aber jeder Euro, der an diese Keilerfirmen kommt, ist einer weniger, der den eigentlichen Organisationen hilft.

Viele Leute spenden auch unreflektiert an die großen, wie z.B. Greenpeace. Weil „die haben einen bekannten Namen und die werden schon positives machen mit dem Geld“? Denkste. Viel ihres Budgets geht dafür drauf, neue Spender zu finden.

Und dann machen sie aktivst gegen Gentechnik Stimmung. Der Gründervater von Greenpeace hat sich von Greenpeace distanziert, weil damals „ein Wissenschaftler auf einem Raum voller Aktivisten kam“. Dass Golden Rice den Vitamin A-Mangel in der dritten Welt bekämpfen könnte (Gloden Rice ist Open Source, also nicht patentiert) ist denen egal – „Gen ist Pfui“. Dass 99.999999% aller Studien sagen, dass die zugelassenen Gentechnischen Pflanzen sicher sind, interessiert sie nicht. Es wird einfach suggeriert, dass Konzerne riesen Mächte hätten und alles unter den Tisch kehren. Die Dynamik ist richtig interessant – Greenpeace stellt sich als kleiner Mann gegen die Großkonzerne da, und der Mainstream kämpfe alles für Gentechnik um uns zu vergiften. Fakt ist, Greenpeace zeigt keine Alternativen. Immer nur dagegen sein (damit lässt sich aber scheinbar eh genug Geld machen). Wissenschaftler überall auf der Welt bringen neue Gene in Pflanzen ein, um sie z.B. trockenheitsresistenter zu machen (also werden keine Pestizidresistenzen eingebaut), nur leider kann sich nur Monsanto leisten Genpflanzen zuzulassen (die regulatorischen Behörden verlangen viele Millionen Dollar, die sich kleine Unis nicht leisten können). Und Pestizidresistenzen verkaufen sich am besten. Natürlich findet man dann Spuren der eingesetzten Pestizide auf den Pflanzen (no na). Wobei die Bio-Spritzmittel oftmals noch giftiger sind (Bio Kupfersulfat ist rund 187 mal giftiger als Glyphosat – https://www.geneticliteracyproject.org/2016/05/09/popular-organic-pesticide-copper-sulfate-compare-synthetic-ones-like-glyphosate/ )

Wir könnten schon viel mehr Krankheiten heilen. Aber (größtenteils) nicht weil „Big Pharma“ die Therapien zurückhält, sondern weil Forschung chronisch unterfinanziert ist. Und weil es 15 Jahre dauert und ~1 Milliarde $ kostet, ein Medikament auf den Markt zu bringen. Auch wenn jemand im Endstadium Krebs ist und nur noch Wochen zu leben hat, wird ihm die Möglichkeit enthalten, experimentelle Therapien auszuprobieren. Hoffentlich ändern da die Regulationsbehörden bald was –momentan lähmt die Angst, dass ein Patient durch eine experimentelle Therapie zu schaden kommen könnte. Gleichzeitig sterben aber tausende an den Folgen des nicht-Eingreifens. Das ist aber eine andere Story. Zurück zum Spenden.

Lange Rede kurzer Sinn, es kann sehr hilfreich sein, zu Googlen.  Sie kennen jemanden, der Kreuzfeld-Jakob hat? Dann können sie die Forschungsgruppen direkt unterstützen – einfach Googlen. „Prion vaccine“

Google Scholar zeigt speziell wissenschaftliche Studien. https://scholar.google.at/

https://www.ncbi.nlm.nih.gov/pubmed/17234125 -> „Vaccination against prion diseases. Kalinke U1, Bach PKönig MBuchholz CJ.“ Author information: 1Divisions of Immunology and Medical Biotechnology, Paul-Ehrlich-Institut, Paul-Ehrlich-Str. 51-59, 63225 Langen, Germany. Dieses Institut forscht z.B. also gegen Prionen (KFJ beim Menschen). -> Google findet deren Seite  http://www.pei.de/EN/institute/organisation/division-6-medical-biotechnology/division-6-medical-biotechnology-node.html

Alzheimer:

https://scholar.google.at/scholar?hl=en&q=alzheimer&btnG=&as_sdt=1%2C5&as_sdtp=

Accelerated Alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor proteinand presenilin 1 transgenes

Leigh Holcomb1, Marcia N. Gordon1, Eileen McGowan2, Xin Yu2, Stan Benkovic1, Paul Jantzen1, Kristal Wright1, Irene Saad1, Ryan Mueller1, 5, Dave Morgan1, Sunny Sanders2, Cindy Zehr2, Kassandra O’Campo2, John Hardy3, Cristian-Mihail Prada4, Chris Eckman4, Steve Younkin4, Karen Hsiao5 & Karen Duff2

1Alzheimer’s Research Laboratory, Department of Pharmacology, University of South Florida, Tampa, Florida 33612, USA

2Neurotransgenics Laboratory, Mayo Clinic, Jacksonville, Florida 32224, USA email duff.karen@mayo.edu

3Neurogenetics Laboratory, Mayo Clinic, Jacksonville, Florida 32224, USA

4Molecular Neuropathology Laboratory, Mayo Clinic, Jacksonville, Florida 32224, USA

5Department of Neurology, University of Minnesota, UMHC Box 295, 420 Delaware Street, Minneapolis, Minnesota 55455, USA

Correspondence should be addressed to K.D.; e-mail duff.karen@mayo.edu.

Correspondence regarding behavior and pathology methodlogy be addressed to D.M. L.H. and M.N.G contributed equally to this work.

So kann man aktiv für Forschung spenden, die einem am Herzen liegt. Englisch ist halt Weltsprache, und es hat sich so entwickelt, dass jede wissenschaftliche Arbeit in Englisch veröffentlicht wird. Also immer nach Englischen Bezeichungen suchen (z.B. Lung Cancer = Lungenkrebs; Muscular Dystrophy; etc)

Promoters of the day – EF1a

EF1a – a „strong“ native mammalian promoter active in most or all tissues. Not as strong as viral promoters like CMV. Tends not to get silenced (like CMV does). Sometimes the EF1a core promoter with CMV enhancer is used.

Citing Invivogen “The EF-1 alpha gene encodes for elongation factor-1 alpha which is one of the most abundant proteins in eukaryotic cells and is expressed in almost all kinds of mammalian cells. The promoter of this “housekeeping” gene exhibits a strong activity, higher than viral promoters such as SV40 and RSV promoters1 , and on the contrary to the CMV promoter, yields persistent expression of the transgene in vivo2 . The rat EF-1α promoter shares a 45.05% homology to the human EF-1α promoter.” ( http://www.yrgene.com/documents/promoter/pdrive-ref1a_tds.pdf )

 

Native genomic mouse EF1a:

GGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCTCAGGGCTGAGCGCGGGGAGAGCAGAGCACACAAGCTCATAGACCCTGGTCGTGGGGGGGAGGACCGGGGAGCTGGCGCGGGGCAAACTGGGAAAGCGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGCAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGGTGAGGGGCGGGTGTGGCTTCCGCGGGCCGCCGAGCTGGAGGTCCTGCTCCGAGCGGGCCGGGCCCCGCTGTCGTCGGCGGGGATTAGCTGCGAGCATTCCCGCTTCGAGTTGCGGGCGGCGCGGGAGGCAGAGTGCGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGAGGCCTAGCGTGGTGTCCGCGCCGCCGCCGCGTGCTACTCCGGCCGCACTCTGGTCTTTTTTTTTTTTGTTGTTGTTGCCCTGCTGCCTTCGATTGCCGTTCAGCAATAGGGGCTAACAAAGGGAGGGTGCGGGGCTTGCTCGCCCGGAGCCCGGAGAGGTCATGGTTGGGGAGGAATGGAGGGACAGGAGTGGCGGCTGGGGCCCGCCCGCCTTCGGAGCACATGTCCGACGCCACCTGGATGGGGCGAGGCCTGGGGTTTTTCCCGAAGCAACCAGGCTGGGGTTAGCGTGCCGAGGCCATGTGGCCCCAGCACCCGGCACGATCTGGCTTGGCGGCGCCGCGTTGCCCTGCCTCCCTAACTAGGGTGAGGCCATCCCGTCCGGCACCAGTTGCGTGCGTGGAAAGATGGCCGCTCCCGGGCCCTGTTGCAAGGAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGGGCGGGTGAGTCACCCACACAAAGGAAGAGGGCCTGGTCCCTCACCGGCTGCTGCTTCCTGTGACCCCGTGGTCCTATCGGCCGCAATAGTCACCTCGGGCTTTTGAGCACGGCTAGTCGCGGCGGGGGGAGGGGATGTAATGGCGTTGGAGTTTGTTCACATTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTGGAAGTCATTTTTGGAATTTGTCCCCTTGAGTTTTGAGCGGAGCTAATTCTCGGGCTTCTTAGCGGTTCAAAGGTATCTTTTAAACCCTTTTTTAGGTGTTGTGAAAACCACCGCTAATTCAAAGCAAT

 

The context in which invivogen uses it in the plasmid pDRIVE-mEF1 is:

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCTCAGGGCTGAGCGCGGGGAGAGCAGAGCACACAAGCTCATAGACCCTGGTCGTGGGGGGGAGGACCGGGGAGCTGGCGCGGGGCAAACTGGGAAAGCGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGCAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGGTGAGGGGCGGGTGTGGCTTCCGCGGGCCGCCGAGCTGGAGGTCCTGCTCCGAGCGGGCCGGGCCCCGCTGTCGTCGGCGGGGATTAGCTGCGAGCATTCCCGCTTCGAGTTGCGGGCGGCGCGGGAGGCAGAGTGCGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGAGGCCTAGCGTGGTGTCCGCGCCGCCGCCGCGTGCTACTCCGGCCGCACTCTGGTCTTTTTTTTTTTTGTTGTTGTTGCCCTGCTGCCTTCGATTGCCGTTCAGCAATAGGGGCTAACAAAGGGAGGGTGCGGGGCTTGCTCGCCCGGAGCCCGGAGAGGTCATGGTTGGGGAGGAATGGAGGGACAGGAGTGGCGGCTGGGGCCCGCCCGCCTTCGGAGCACATGTCCGACGCCACCTGGATGGGGCGAGGCCTGGGGTTTTTCCCGAAGCAACCAGGCTGGGGTTAGCGTGCCGAGGCCATGTGGCCCCAGCACCCGGCACGATCTGGCTTGGCGGCGCCGCGTTGCCCTGCCTCCCTAACTAGGGTGAGGCCATCCCGTCCGGCACCAGTTGCGTGCGTGGAAAGATGGCCGCTCCCGGGCCCTGTTGCAAGGAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGGGCGGGTGAGTCACCCACACAAAGGAAGAGGGCCTGGTCCCTCACCGGCTGCTGCTTCCTGTGACCCCGTGGTCCTATCGGCCGCAATAGTCACCTCGGGCTTTTGAGCACGGCTAGTCGCGGCGGGGGGAGGGGATGTAATGGCGTTGGAGTTTGTTCACATTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTGGAAGTCATTTTTGGAATTTGTCCCCTTGAGTTTTGAGCGGAGCTAATTCTCGGGCTTCTTAGCGGTTCAAAGGTATCTTTTAAACCCTTTTTTAGGTGTTGTGAAAACCACCGCTAATTCAAAGCAATC ATG AGC GGT TCT CAT CAT CAT CAT CAT CAT GGT

With ATG being the start codon, adding a N-terminal His tag.

 

 

This *should* be the rat EF1a promoter, difficult to read from their annotation. In small letters may be the intron that each EF1a has.

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCCCAGGGCTGAGCGCGGGTAGATCAGAGCACACAAGCTCACAGTCCCCGGCGGTGGGGGGAGGGGCGCGCTGAGCGGGGGCCAGGGAGCTGGCGCGGGGCAAACTGGGAAAGTGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGTAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGgtgagtggcgggtgtggcttccgcgggccccggagctggagccctgctctgagcgggccgggctgatatgcgagtgtcgtccgcagggtttagctgtgagcattcccacttcgagtggcgggcggtgcgggggtgagagtgcgaggcctagcggcaaccccgtagcctcgcctcgtgtccggcttgaggcctagcgtggtgtccgccgccgcgtgccactccggccgcactatgcgttttttgtccttgctgccctcgattgccttccagcagcatgggctaacaaagggagggtgtggggctcactcttaaggagcccatgaagcttacgttggataggaatggaagggcaggaggggcgactggggcccgcccgccttcggagcacatgtccgacgccacctggatggggcgaggcctgtggctttccgaagcaatcgggcgtgagtttagcctacctgggccatgtggccctagcactgggcacggtctggcctggcggtgccgcgttcccttgcctcccaacaagggtgaggccgtcccgcccggcaccagttgcttgcgcggaaagatggccgctcccggggccctgttgcaaggagctcaaaatggaggacgcggcagcccggtggagcgggcgggtgagtcacccacacaaaggaagagggccttgcccctcgccggccgctgcttcctgtgaccccgtggtctatcggccgcatagtcacctcgggcttctcttgagcaccgctcgtcgcggcggggggaggggatctaatggcgttggagtttgttcacatttggtgggtggagactagtcaggccagcctggcgctggaagtcattcttggaatttgcccctttgagtttggagcgaggctaattctcaagcctcttagcggttcaaaggtattttctaaacccgtttccagGTGTTGTGAAAGCCACCGCTAATTCAAA

 

They way they use it

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCCCAGGGCTGAGCGCGGGTAGATCAGAGCACACAAGCTCACAGTCCCCGGCGGTGGGGGGAGGGGCGCGCTGAGCGGGGGCCAGGGAGCTGGCGCGGGGCAAACTGGGAAAGTGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGTAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGgtgagtggcgggtgtggcttccgcgggccccggagctggagccctgctctgagcgggccgggctgatatgcgagtgtcgtccgcagggtttagctgtgagcattcccacttcgagtggcgggcggtgcgggggtgagagtgcgaggcctagcggcaaccccgtagcctcgcctcgtgtccggcttgaggcctagcgtggtgtccgccgccgcgtgccactccggccgcactatgcgttttttgtccttgctgccctcgattgccttccagcagcatgggctaacaaagggagggtgtggggctcactcttaaggagcccatgaagcttacgttggataggaatggaagggcaggaggggcgactggggcccgcccgccttcggagcacatgtccgacgccacctggatggggcgaggcctgtggctttccgaagcaatcgggcgtgagtttagcctacctgggccatgtggccctagcactgggcacggtctggcctggcggtgccgcgttcccttgcctcccaacaagggtgaggccgtcccgcccggcaccagttgcttgcgcggaaagatggccgctcccggggccctgttgcaaggagctcaaaatggaggacgcggcagcccggtggagcgggcgggtgagtcacccacacaaaggaagagggccttgcccctcgccggccgctgcttcctgtgaccccgtggtctatcggccgcatagtcacctcgggcttctcttgagcaccgctcgtcgcggcggggggaggggatctaatggcgttggagtttgttcacatttggtgggtggagactagtcaggccagcctggcgctggaagtcattcttggaatttgcccctttgagtttggagcgaggctaattctcaagcctcttagcggttcaaaggtattttctaaacccgtttccagGTGTTGTGAAAGCCACCGCTAATTCAAAGCAACC ATG GGG GGT TCT CAT CAT CAT CAT CAT CAT

 

This is the one from chimp:

GCTCCGGTTCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGACAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGgtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccatgcccctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcttgggcgctggggccgccgcgtgctaatctggtggcaccttcgcgcctgtctcgctgctttcgctaagtctctagccatttaaaatttttgataaccagctgcgacgctttttttctggcgagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaaactggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgcccgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccttcctcatccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttgcctcattctcaagcctcagacagtggttcaaagtttttttcttccatttcagGTGTCGTGA

in context:

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGACTCGCCCCTGCCTTGGGGAATCCCAGGGACCGTCGTTAAACTCCCACTAACGTAGAACCCAGAGATCGCTGCGTTCCCGCCCCCTCACCCGCCCGCTCTCGTCATCACTGAGGTGGAGAAGAGCATGCGTGAGGCTCCGGTTCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGACAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGgtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccatgcccctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcttgggcgctggggccgccgcgtgctaatctggtggcaccttcgcgcctgtctcgctgctttcgctaagtctctagccatttaaaatttttgataaccagctgcgacgctttttttctggcgagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaaactggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgcccgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccttcctcatccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttgcctcattctcaagcctcagacagtggttcaaagtttttttcttccatttcagGTGTCGTGAAAACTACCCCTAAAAGCCACC ATG GGG GGT TCT CAT CAT CAT CAT CAT CAT

This is a EF1a core promoter plus CMV enhancer (EF1a core promoter underlined; enhancer upstream):

ACATGTTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGAATTGGTTTGATCTGATTATAACTAGTGGAGAAGAGCATGCTTGAGGGCTGAGTGCCCCTCAGTGGGCAGAGAGCACATGGCCCACAGTCCCTGAGAAGTTGGGGGGAGGGGTGGGCAATTGAACTGGTGCCTAGAGAAGGTGGGGCTTGGGTAAACTGGGAAAGTGATGTGGTGTACTGGCTCCACCTTTTTCCCCAGGGTGGGGGAGAACCATATATAAGTGCAGTAGTCTCTGTGAACATTCGCTAGCAGATCT

 

 

 

Sequence Repository

Just found this. A ribozyme that cleaves itself, unless it binds tetracyclin. Proven to work in mammalian cells.
You just have to embedd this ribozyme into a mRNA, ideally direcly after the stop codon (3’UTR). CAAA3 is used as a spacer so the ribozyme folding is more smooth, presumably because A-T binding is a lot weaker than G-C.
Seems to be very helpful when you want to use tetracycline to activate gene expression but you don’t want to introduce foreign proteins (such as the tet-transcativator that then binds a tet-operator-CMV Promoter). Without tetracycline in the medium, the mRNA cleaves itself and you get only ~25% of the expression because mRNA without a polyA tail is rapidly degraded. When you add 50 uM tet, the ribozyme is prevented from cutting itself and you get the full expression.

caaacaaacaaa
GGCGCGTCCTGGATTCGTACAAAACATACCAGATTTCGATCTGGAGAGGTGAAGAATACGACCACCTGTACATCCAGCTGATGAGTCCCAAATAGGACGAAACGCGCT
aacaaaacaaac

The ribozyme is described in the study “Conditional Control of Mammalian Gene Expression by Tetracycline-Dependent Hammerhead Ribozymes” by Kim Beilstein, Alexander Wittmann, Manuel Grez, and Beatrix Suess. I had ty type it in from the graphic, always annowing when the full sequence isn’t given in a format that’s copyable.3k4-tet-ribozyme

Alledgedly there is a better ribozyme from the study “Rational design of aptazyme riboswitches for efficient control of gene expression in mammlian cells” that has 20 fold repression wiothout tetracyclin. Unfortunately they hid their sequence very well in the paper and I have to reverse engineer all of their paper to find the sequence they used. #moretransparencyinqualityjournalsplease

 

EDIT: The author of  “Rational design of aptazyme riboswitches for efficient control of gene expression in mammlian cells” has kindly replied to my email the next day. He provided the sequences:

>TC40

GGAUCCAAACAAACAAACUGAGGUGCAGGUACAUCCAGCUGACGAGUCCCAAAUAGGACGAAAGGGAGAGGUGAAGAAUACGACCACCUAGGCUCGAAAGAGCCUAAAACAUACCUUCCUGGAUUCCACUGCUAUCCACAAAAAGAAAAAUAAAAAGAAUUC

>Theo5

GGAUCCAAACAAACAAACUGAGGUGCAGGUACAUCCAGCUGACGAGUCCCAAAUAGGACGAAAGGAAUACCAGCCGAAAGGCCCUUGGCAGUCUUCCUGGAUUCCACUGCUAUCCACAAAAAGAAAAAUAAAAAGAAUUC

Yellow/orange:aptazyme sequence

Bold underlined: communication module

Warum Biotechnologie die Grippe und den Krebs noch nicht besiegt hat

http://www.strike-the-root.com/51/walker/walker6.html

“Column by Bill Walker, posted on April 20, 2005
in

Other

I shovel telomeres for a living. My friends in the computer industry are always asking me: ‘Why can’t you biotech guys cure cancer? Or aging? Or the common cold? What do you do with all those billions of government research dollars?’

Well, it’s time to confess: Biologists bought three stuffed mice and two petri dishes in 1974. These are recycled in staged publicity photos in such high-profile popular glossies as Proceedings of the National Academy of Sciences, Cell, and Eur J Gastroenterol Hepatol. Our much-hyped ‘gene sequencing,’ ‘chromosome imaging,’ etc. are all done on Photoshop by companies in Taipei . All the rest of the money goes to yachts, scuba equipment, and private islands in Fiji for all postdocs and research associates. That’s why medical researchers always look so tanned and vigorous.

OK, seriously: If the computer industry were running under the same conditions as biotech, this is how it would work:

There would be a Federal Data Administration (FDA). Every processor, peripheral, program, printer, and power cord made in or imported into the USA would have to obtain FDA approval. This would require an average of 19 years of safety testing on lab rats and clinical trials for effectiveness on nerd volunteers with informed consent, before prescription for general human use is allowed. Any change of any kind to any chip, ergonomic keyboard, or line of code would require re-approval of the entire system and any hardware or software that could in principle be connected to it via Internet, intranet, or hand-carried disk.

In the medical system, this sort of approval can be done for only a bit over $802 million per drug or medical device (Tufts study, 2001). So it might cost only a few times more when applied to a global industry producing next-generation silicon chips. Anyway, how can anyone put a price tag on safety? Think of the children!

Today even someone who dropped out of college could legally own a large software company. To remedy this unconscionable state of affairs, state licensing boards would be created to require American Mainframe Association (AMA) membership for all computer professionals. This would ensure that all programmers go to college and postgraduate school for at least eight years, and then serve multi-year nerdships and residencies before being allowed to practice independently. Thus programmers would be fully prepared to start writing BASIC programs by age 28-30, and attain full professional status by their 40s.

These AMA professionals would prescribe for consumers the ‘right’ hardware and software (within the prescribing and cost limits of the appropriate HMO, see below). To guard against improper (‘recreational’) use of computers, all information products would now require a prescription from a professional.

A Data Enforcement Agency (DEA) would be empowered under the asset forfeiture laws to confiscate the property of smugglers and users of illegal data processing paraphernalia, such as that used in so-called ‘video games’ or ‘palm pilots.’ The DEA would also have the responsibility of ensuring that no unapproved data flows in or out of our borders.

Then the IRS would make buying computers for the home use of employees a deductible expense for employers (but not for employees), as is true of health insurance today. Companies would be forced to buy computers for their employees through Hardware Maintenance Organizations (HMOs), instead of allowing the employees to buy them directly.

Finally, the Federal government would hire hundreds of thousands of programmers and chip designers to work in government-run ‘computer research,’ controlled by NIH, the various armed services, and other fountains of innovation. Private ‘cybertech’ companies could have whoever was left over . . . if they could figure out how to con investors into funding companies which were rarely allowed to sell their products.

If we had really let government run the computer industry this way, there would be no Intel, IBM or Apple. There would be no chip industry. There would be no Internet. The NIH would be funding hundreds of labs to develop better vacuum tubes.

Now, all you programmers who are snickering at the poor dumb biologists: let me point out something. You, personally, aren’t made of doped silicon. You are made of DNA and some other junk banging around inside lipid bilayers. If you want to improve your life in any meaningful way, you need to be able to buy stuff to upgrade your DNA system.

Some organisms, like Bowhead whales, already manage to make DNA systems work for over 200 years. That means their cancer control is 1,000 times as good as ours (twice the lifespan times 500 times the cell number), and their aging control is at least twice as good. A real free-market biotech industry could pirate these already-existing DNA programs and sell them to you cheap (whales don’t get royalties, and DNA replicates as easily as chips do).

So, since you computer guys have all the money, it would behoove you to use a little of it to get rid of the FDA and all the rest of the medieval guild nonsense that encrusts the biotech industry. Then you would finally see some progress against cancer and aging.

Oh, the common cold? We could wipe out the existing varieties, but RNA and DNA hackers will always resequence new types. Viruses will always be with us; you just have to continuously update your immune system’s definitions. “

“Natürlich” vs “Chemisch”

Es ist als Wissenschafftler furchtbar traurig zu lesen, wie Leute die Chemie verunglimpfen. Medizin die “pflanzlich” ist, wird als gut und gesund und arm an Nebenwirkungen gesehen, während “chemische Stoffe” als böse angesehen werden und von der bösen Pharmaindustrie gemacht werden, um uns zu schaden.

Was die wenigsten Wissen a) viele der “chemischen Medikamente” kommen ursprünglich aus Pflanzen. Nur leider kommt es da häufig vor dass das Blatt einer Pflanze mal 1 mg eines Wirkstoffes enthält, und das Blatt der Pflanze daneben gar 50 mg. Aussagekräftige Studien können aber nur gemacht werden (und Effekte erzielt) wenn man Tabletten hat, in denen jeden Tag das selbe (z.B. 20 mg) drinnen ist.
Darum werden aus dem Stoffgemisch (in jedem Pflanzenbatt sind 1000e verschiedener Chemikalien drinnen) einzelne Stoffe (“Chemikalien”) aufgereinigt und auf bestimmte Gehalte in Tabletten gepresst.

b) “Natürliche” Heilmittel machen bei weitem den größten Profit für Apotheken. Antibiotika werden in der Regel fast zum selbst-kostenpreis erzeugt. Darum haben Pharmafirmen seit ca 20 Jahren keine neuen Antibiotika auf den Markt gebracht.

Medizin zu erzeugen ist extrem aufwendig. Zuerst muss ein Medikament entdeckt werden. Das “Screening” vieler verschiedener Stoffklassen geschieht oft in Mäusen. Dann gibt es Studein am Menschen, zuerst beweist man die Sicherheit (keine Vergiftung von dem Stoff bei eingesetzten Dosen), dann die Effektivität (hemmt der Stoff das Grippevirus?). Bis ein Produkt auf den Markt zugelassen wird, dauert es 12 Jahre und viele, viele Millionen Dollar (wieviele? Muss mal googlen). Im Produktionsprozess, alleine die Maschinen und Reaktoren müssen laut Gesetz gewährleisten, dass man reines Produkt bekommt. Nur am Schluss zu messen, was herauskommt (z.B: mittels HPLC) ist nicht zulässig. Wenn der Gehalt an Wirkstoff ein bisschen abweicht, muss die ganze Charge (zB Tagesproduktion oder Wohenproduktion) vernichtet werden. Das alles, um dem Konsumenten Sicherhiet zu geben, dass sein Medikament sicher und effektiv ist.

Jetzt gibt es eine Ausnahme im Medizingesetzt. “Hausmittel” dürfen frei verkauft werden. Das heißt, ich nehme eine alte Pflanze, zum Beispiel Urgerste oder Erdbeeren und schreibe darauf “altes Hausmittel gegen Husten”. Das ist völlig legal.

Was ich vor einiger Weile in einer Apotheke sah: Eine Frau kam herein und meinte “ich brauch etwas gegen Husten für mein Kind”. Der Apotheker meinte “da habe ich zum Beispiel das hier” und zeigte auf eine Packung für 9,90€ daraufhin die Frau: “ist das eher was natürliches?” “Nein, da haben wir das”, meinte der Apotheker und zeigte auf eine Schachtelhalm-Saftflasche für 25€. Sofort nahm die Frau das. Ich verkniff mir, mir an den Kopf zu greifen. Den Apotheker hats sicher gefreut – mehr Profit gemacht.

Nun bin ich keineswegs gegen pflanzliche Medizin – die meisten unserer Medizinischen Stffe wurden ja in Pflanzen entdeckt. Oftmals auch kommen in Pflanzen Wirkstoffkombinationen vor, die besser wirken als nur eine Reeinsubstanz. Aber nur weil es “natürlich” ist, das Produkt automatisch dem “chemischen” vorzuziehen ist einfach nur dumm.

Zu den Risiken von Gentechnik

Leider wird keine sachliche Debatte geführt. Laut dem Gentechnikgesetz gelten radioaktiv bestrahlte Samen nicht als Gentechnik – nachher schaut der Züchter an ob die Äpfel größer oder röter sind. Die hunderten von Gene, die dabei von der Strahlung völlig zufällig mutiert werden – unvorhersehbare Effekte! – sind dem Gesetzgeber scheinbar völlig egal. Solche Pflanzen brauchen keine extra Zulassung.

Aber auch traditionelle Kreuzung ist nicht ohne Risiken. Bei der sexuellen Kreuzung zweier Sorten werden rund die Hälfte der Gene von Vater und Mutterpflanze bunt durcheinandergewürfelt. Transposons springen im Genom herum. Antike Retroviren  werden vielleicht aktiv. Traditionelle Züchtung hat bei Kartoffelsorten schon einmal zu einer Sorte geführt, die toxisch für den Menschen war.

http://www.gute-gene-schlechte-gene.de/gift-gene-zuchtung-lenape-kartoffel/

In gentechnisch veränderte Pflanzen wird nur ein einziges Gen (oder ein paar Gene) eingebracht, dessen Funktion genau bekannt ist. Man kann im Vorherein bereits abschätzen, ob es Risiken im Bezug auf Umwelt und Gesundgheit gäbe. Mittels Fütterungsstudien an Tieren wird dann noch bewiesen, dass diese Pflanzen unbedenklich sind. Trotzdem gibt es dann immer noch Schreier, die den Leuten Angst einjagen vor Genpflanzen. Und sinnvolle Projekte wie Golden Rice behindern, lobbying betreiben dass ihre Finanzierung gestrichen wird, um Jahre verzögert, und dann deren Testfelder zerstampft.

 

Oft argumentiert wird auch mit dem naturalistischen Fehlschluss. Werbung will uns weißmachen, alles natürliche sei gut. Und da viele Menschen heute weit weg von der Natur leben, klingt das auch einleuchtend. Wir romantisieren die “gute Natur”. Im Mittelalter war die Natur angsteinflößend und gefährlich für die Menschen, da reale Gefahren von natürlichen Seuchen, Raubtieren, etc. bestanden hatte.

Man denke nur an giftige Pilze, Krankheiten, etc. Das ist alles “ganz natürlich”. Trotzdem sind das zweifelsohne schlechte Sachen. Ein Doktor, der einem Herzinfarktpatienten das Leben rettet – spielt der Gott? Hätte der erwähnte Mann nicht von Natur ausd sterben müssen? Menschen mit körperlichen Behinderungen werden von der Gesellschaft mitgetragen, auch wenn sie in freier Wildbahn nicht überleben würden. Das ist unnatürlich – und trotzdem wuird keiner sagen, das sei unnatürlich und schlecht.

Golden Rice – DIY

Dieser Post soll den Prozess aufschlüsseln, wie man Reis genverändern kann, sodass er VitaminA erzeugt „Golden Rice“. Die Idee für diesen Artikel kam von einer Podiumdiskussion der Friedrich-Ebert Stiftung, zu der ich eingeladen bin. In dieses Beispiel werde ich auch ethische Fragen, die damit verbunden sind, einflechten.

Der Goldene Reis produziert Beta-Carotin, also den direkten Vorgängerstoff von VitaminA- Jednen Tag sterben 20‘000 Menschen an VitaminA Mangel (ein furchtbarer Tod, weil man zuvor daran blind wird). Warum wir den Reis nicht gleich Vitamin A direkt produzieren lassen? 1) der menschliche Körper kann Vitamin A aus b-Carotin erzeugen, also wäre es unnötig, das  Gen in die Pflanze einbauen.  2) Isst man zuviel VitaminA, kann das schädlich für den Körper sein. Isst man zuviel b-Carotin, wird der Überschuss mit dem Urin ausgeschieden.

https://www.ncbi.nlm.nih.gov/nuccore/X78814

https://www.ncbi.nlm.nih.gov/nuccore/22474502

https://www.ncbi.nlm.nih.gov/nuccore/1419692

Dies sind die genetischen Baupläne für einen Vitamin A Stoffwecheslweg.

Wir brauchen die drei Gene – Psy, Crtl, Lyc.

vita-pathway.jpg

Auszug aus dem open access Paper from der American Society for Nutritional Sciences

Pflanzenzellen enthalten bereits GGPP (Geranylgeranyl pyrophosphate) – welches ein ziemlich wichtiges, zentrales Glied im Stoffwechsel ist, das mittels Enzymen in viele andere Stoffe umgewandelt werden kann.

Wie an dem Bild ersichtlich, müssen wir in den Reis ein Gen einbringen, dass das Enzym „Phytoene Synthase“ codiert. Dieses Enzym verwandelt das Zelleigene GGPP der Pflanze in Phytoene.

Weiters wollen wir das entstandene Phytoene in Lykopen (Lycopene ist ein gesunder Stoff in z.B. Tomaten) umbauen. Dazu verwenden Pflanzen normalerweise zwei Enzyme – allerdings haben Forscher in einem Bakterium ein Enzym gefunden, dass diese zwei Schritte auf einmal machen kann.

Als letzten Schritt brauchen wir noch ein Enzym, dass das entstandene Lykopen weiterverarbeitet zu b-Carotin. Das Enzym heißt lycopene cyclase.

Enzyme sind Biokatalysatoren, die extreme spezifisch wirken. Jedes Enzym erfüllt nur einen Job – der Stoff, den das Enzym verändert passt in das aktive Zentrum des Enzymes und wird dann umgebaut. Das ist im völligen Gegensatz zu Reaktionen in der technischen Chemie, wo Stoffe oft bei 120°C in Schwefelsäure gekocht werden, und sich dann Stoffgemische (Isomere bilden). Die Medien behaupten immer, Gentechnik hätte irgendwelche unvorhergesehenen Effekte haben – aber in dieser Hinsicht gibt es die definitiv nicht. Mit molekular Modelling Software kann man sogar am Computer berechnen, welcher Stoff an welches Enzym bindet.

 

 

Kleine Abschlussnote von der biotechnologischen Seite. Die Foscher haben in dieser wissenschaftlichen Arbeit die Enzyme in die Chloroplasten gebracht (vermutlich weil da das meiste GGPP ist), mittels Signalpeptiden. Zur Vereinfachung wurde das einmal weggelassen.

Am Schluss ware noch zu erwähnen, dass unsere Ur-Ur Ahnen einmal deren eigenes VitA erzeugen konnten. Wir haben die Enzyme noch in unserer chromosomalen DNA, aber im Laufe der Evolution hatten wir eine Mutation in einem Gen, worauf dessen Struktur verändert wurde und das Enzym nichtmehr aktiv war. Nun ist es nicht so wie in Horror-Filmen, dass  solche Mutationen die Menschen in Zombies oder Vampire verwandeln. Das Enzym wurde weiterhin erzeugt, ist aber quasi eine Leiche, ein Relikt der Evolution und kann keine Aufgabe in der Zelle mehr tun – schadet aber ihr aber auch nicht (bis auf den recht geringen Energieverbrauch, das unnötige Enzym herzustellen). menschlichen Zellen findet man haufenweise Relikte, die durch Mutationen funktionslos wurden. Die VitA Mutation schadete dem Menschen nicht recht (außer den Menschen, die kein vitaminA mit der Nahrung aufnahmen).

DIY Golden Rice – genes

Long time no write. This post will soon decipher the genes needed to turn normal rice into Golden Rice. Golden Rice produces Beta-Carotene, which is a direct precursor to VitaminA. 20.000 people a day die because of vitamin A deficiency (which is a horrbile death btw, because you become blind first). Why not produce VitaminA? First the human body can produce VitA from Beta-carotene. It would be adding an unneccesary gene to the construct. Secondly, and more importantly, you cannot overdose beta-carotene. If you eat too much vitA you can get intoxication – if ou eat too much beta-carotene your body disposes of it with the urine.

https://www.ncbi.nlm.nih.gov/nuccore/X78814

https://www.ncbi.nlm.nih.gov/nuccore/22474502

https://www.ncbi.nlm.nih.gov/nuccore/1419692

Here is the paper describing the newly engineered pathway.

These are the three genes we need – Psy, Crtl, Lyc.

 

vitA pathway.jpg

figure from the open access paper from The American Society for Nutritional Sciences

 

Plant cells already contain GGPP (Geranylgeranyl pyrophosphate) – it is a pretty important molecule that is the basis of many other pathways. So as you see we need to add a Phytoene Synthase gene which codes for the protein enzyme Phytoene Synthase which turns the plant cells’ GGPP into Phytoene. Usually plants employ two enzymes to go from Phytoene to Lycopene (Lycopene is e.g. one of the healthy compounds in tomatoes) but here we take a shortcut: a characterized bacterial gene Crtl can do this in one step. Last step is an enzyme that converts Lycopene into Beta-Carotene, hence we need a lycopene cyclase.

Each enzyme does one job only – enzymes work like key lock systems. The precursor molecules fit into the cavity or “active center” in the protein enzyme and the enzyme catalyzes their specific reaction. Whatever the media fearmongered you – there are no unforseen side-effects in this regard. Unlike chemical synthesis (where catalysis can e.g. be done at 120°C in sulfuric acid) the enzyme is VERY specific.

 

A little not at the end of this post: Our far-far ancestors’ bodies were actually able to produce vitamin A themselves.We still have the enzymes in our chromosomal DNA – but there was a mutation that rendered our vitaminA biosynthesis proteins useless. Unlike in horror movies, these mutations don’t made them zombies though. The enzyme’s structure was just destroyed, and the precursor molecule wouldn’t fit in anymore. So speaking, human cells have lots of “corpse-proteins” in them that lost their function but are still expressed. The cell doesn’t know what function proteins have so they keep producing even the mutated forms. Obviosly this wasn’t of harm to us – unless we didn’t eat enough vitamin A.