EF1a – a „strong“ native mammalian promoter active in most or all tissues. Not as strong as viral promoters like CMV. Tends not to get silenced (like CMV does). Sometimes the EF1a core promoter with CMV enhancer is used.

Citing Invivogen “The EF-1 alpha gene encodes for elongation factor-1 alpha which is one of the most abundant proteins in eukaryotic cells and is expressed in almost all kinds of mammalian cells. The promoter of this “housekeeping” gene exhibits a strong activity, higher than viral promoters such as SV40 and RSV promoters1 , and on the contrary to the CMV promoter, yields persistent expression of the transgene in vivo2 . The rat EF-1α promoter shares a 45.05% homology to the human EF-1α promoter.” ( http://www.yrgene.com/documents/promoter/pdrive-ref1a_tds.pdf )

 

Native genomic mouse EF1a:

GGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCTCAGGGCTGAGCGCGGGGAGAGCAGAGCACACAAGCTCATAGACCCTGGTCGTGGGGGGGAGGACCGGGGAGCTGGCGCGGGGCAAACTGGGAAAGCGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGCAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGGTGAGGGGCGGGTGTGGCTTCCGCGGGCCGCCGAGCTGGAGGTCCTGCTCCGAGCGGGCCGGGCCCCGCTGTCGTCGGCGGGGATTAGCTGCGAGCATTCCCGCTTCGAGTTGCGGGCGGCGCGGGAGGCAGAGTGCGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGAGGCCTAGCGTGGTGTCCGCGCCGCCGCCGCGTGCTACTCCGGCCGCACTCTGGTCTTTTTTTTTTTTGTTGTTGTTGCCCTGCTGCCTTCGATTGCCGTTCAGCAATAGGGGCTAACAAAGGGAGGGTGCGGGGCTTGCTCGCCCGGAGCCCGGAGAGGTCATGGTTGGGGAGGAATGGAGGGACAGGAGTGGCGGCTGGGGCCCGCCCGCCTTCGGAGCACATGTCCGACGCCACCTGGATGGGGCGAGGCCTGGGGTTTTTCCCGAAGCAACCAGGCTGGGGTTAGCGTGCCGAGGCCATGTGGCCCCAGCACCCGGCACGATCTGGCTTGGCGGCGCCGCGTTGCCCTGCCTCCCTAACTAGGGTGAGGCCATCCCGTCCGGCACCAGTTGCGTGCGTGGAAAGATGGCCGCTCCCGGGCCCTGTTGCAAGGAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGGGCGGGTGAGTCACCCACACAAAGGAAGAGGGCCTGGTCCCTCACCGGCTGCTGCTTCCTGTGACCCCGTGGTCCTATCGGCCGCAATAGTCACCTCGGGCTTTTGAGCACGGCTAGTCGCGGCGGGGGGAGGGGATGTAATGGCGTTGGAGTTTGTTCACATTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTGGAAGTCATTTTTGGAATTTGTCCCCTTGAGTTTTGAGCGGAGCTAATTCTCGGGCTTCTTAGCGGTTCAAAGGTATCTTTTAAACCCTTTTTTAGGTGTTGTGAAAACCACCGCTAATTCAAAGCAAT

 

The context in which invivogen uses it in the plasmid pDRIVE-mEF1 is:

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCTCAGGGCTGAGCGCGGGGAGAGCAGAGCACACAAGCTCATAGACCCTGGTCGTGGGGGGGAGGACCGGGGAGCTGGCGCGGGGCAAACTGGGAAAGCGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGCAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGGTGAGGGGCGGGTGTGGCTTCCGCGGGCCGCCGAGCTGGAGGTCCTGCTCCGAGCGGGCCGGGCCCCGCTGTCGTCGGCGGGGATTAGCTGCGAGCATTCCCGCTTCGAGTTGCGGGCGGCGCGGGAGGCAGAGTGCGAGGCCTAGCGGCAACCCCGTAGCCTCGCCTCGTGTCCGGCTTGAGGCCTAGCGTGGTGTCCGCGCCGCCGCCGCGTGCTACTCCGGCCGCACTCTGGTCTTTTTTTTTTTTGTTGTTGTTGCCCTGCTGCCTTCGATTGCCGTTCAGCAATAGGGGCTAACAAAGGGAGGGTGCGGGGCTTGCTCGCCCGGAGCCCGGAGAGGTCATGGTTGGGGAGGAATGGAGGGACAGGAGTGGCGGCTGGGGCCCGCCCGCCTTCGGAGCACATGTCCGACGCCACCTGGATGGGGCGAGGCCTGGGGTTTTTCCCGAAGCAACCAGGCTGGGGTTAGCGTGCCGAGGCCATGTGGCCCCAGCACCCGGCACGATCTGGCTTGGCGGCGCCGCGTTGCCCTGCCTCCCTAACTAGGGTGAGGCCATCCCGTCCGGCACCAGTTGCGTGCGTGGAAAGATGGCCGCTCCCGGGCCCTGTTGCAAGGAGCTCAAAATGGAGGACGCGGCAGCCCGGTGGAGCGGGCGGGTGAGTCACCCACACAAAGGAAGAGGGCCTGGTCCCTCACCGGCTGCTGCTTCCTGTGACCCCGTGGTCCTATCGGCCGCAATAGTCACCTCGGGCTTTTGAGCACGGCTAGTCGCGGCGGGGGGAGGGGATGTAATGGCGTTGGAGTTTGTTCACATTTGGTGGGTGGAGACTAGTCAGGCCAGCCTGGCGCTGGAAGTCATTTTTGGAATTTGTCCCCTTGAGTTTTGAGCGGAGCTAATTCTCGGGCTTCTTAGCGGTTCAAAGGTATCTTTTAAACCCTTTTTTAGGTGTTGTGAAAACCACCGCTAATTCAAAGCAATC ATG AGC GGT TCT CAT CAT CAT CAT CAT CAT GGT

With ATG being the start codon, adding a N-terminal His tag.

 

 

This *should* be the rat EF1a promoter, difficult to read from their annotation. In small letters may be the intron that each EF1a has.

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCCCAGGGCTGAGCGCGGGTAGATCAGAGCACACAAGCTCACAGTCCCCGGCGGTGGGGGGAGGGGCGCGCTGAGCGGGGGCCAGGGAGCTGGCGCGGGGCAAACTGGGAAAGTGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGTAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGgtgagtggcgggtgtggcttccgcgggccccggagctggagccctgctctgagcgggccgggctgatatgcgagtgtcgtccgcagggtttagctgtgagcattcccacttcgagtggcgggcggtgcgggggtgagagtgcgaggcctagcggcaaccccgtagcctcgcctcgtgtccggcttgaggcctagcgtggtgtccgccgccgcgtgccactccggccgcactatgcgttttttgtccttgctgccctcgattgccttccagcagcatgggctaacaaagggagggtgtggggctcactcttaaggagcccatgaagcttacgttggataggaatggaagggcaggaggggcgactggggcccgcccgccttcggagcacatgtccgacgccacctggatggggcgaggcctgtggctttccgaagcaatcgggcgtgagtttagcctacctgggccatgtggccctagcactgggcacggtctggcctggcggtgccgcgttcccttgcctcccaacaagggtgaggccgtcccgcccggcaccagttgcttgcgcggaaagatggccgctcccggggccctgttgcaaggagctcaaaatggaggacgcggcagcccggtggagcgggcgggtgagtcacccacacaaaggaagagggccttgcccctcgccggccgctgcttcctgtgaccccgtggtctatcggccgcatagtcacctcgggcttctcttgagcaccgctcgtcgcggcggggggaggggatctaatggcgttggagtttgttcacatttggtgggtggagactagtcaggccagcctggcgctggaagtcattcttggaatttgcccctttgagtttggagcgaggctaattctcaagcctcttagcggttcaaaggtattttctaaacccgtttccagGTGTTGTGAAAGCCACCGCTAATTCAAA

 

They way they use it

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGAGGGATCGCCTTCGCAAGGGGAGAGCCCAGGGACCGTCCCTAAATTCTCACAGACCCAAATCCCTGTAGCCGCCCCACGACAGCGCGAGGAGCATGCGCCCAGGGCTGAGCGCGGGTAGATCAGAGCACACAAGCTCACAGTCCCCGGCGGTGGGGGGAGGGGCGCGCTGAGCGGGGGCCAGGGAGCTGGCGCGGGGCAAACTGGGAAAGTGGTGTCGTGTGCTGGCTCCGCCCTCTTCCCGAGGGTGGGGGAGAACGGTATATAAGTGCGGTAGTCGCCTTGGACGTTCTTTTTCGCAACGGGTTTGCCGTCAGAACGCAGgtgagtggcgggtgtggcttccgcgggccccggagctggagccctgctctgagcgggccgggctgatatgcgagtgtcgtccgcagggtttagctgtgagcattcccacttcgagtggcgggcggtgcgggggtgagagtgcgaggcctagcggcaaccccgtagcctcgcctcgtgtccggcttgaggcctagcgtggtgtccgccgccgcgtgccactccggccgcactatgcgttttttgtccttgctgccctcgattgccttccagcagcatgggctaacaaagggagggtgtggggctcactcttaaggagcccatgaagcttacgttggataggaatggaagggcaggaggggcgactggggcccgcccgccttcggagcacatgtccgacgccacctggatggggcgaggcctgtggctttccgaagcaatcgggcgtgagtttagcctacctgggccatgtggccctagcactgggcacggtctggcctggcggtgccgcgttcccttgcctcccaacaagggtgaggccgtcccgcccggcaccagttgcttgcgcggaaagatggccgctcccggggccctgttgcaaggagctcaaaatggaggacgcggcagcccggtggagcgggcgggtgagtcacccacacaaaggaagagggccttgcccctcgccggccgctgcttcctgtgaccccgtggtctatcggccgcatagtcacctcgggcttctcttgagcaccgctcgtcgcggcggggggaggggatctaatggcgttggagtttgttcacatttggtgggtggagactagtcaggccagcctggcgctggaagtcattcttggaatttgcccctttgagtttggagcgaggctaattctcaagcctcttagcggttcaaaggtattttctaaacccgtttccagGTGTTGTGAAAGCCACCGCTAATTCAAAGCAACC ATG GGG GGT TCT CAT CAT CAT CAT CAT CAT

 

This is the one from chimp:

GCTCCGGTTCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGACAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGgtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccatgcccctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcttgggcgctggggccgccgcgtgctaatctggtggcaccttcgcgcctgtctcgctgctttcgctaagtctctagccatttaaaatttttgataaccagctgcgacgctttttttctggcgagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaaactggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgcccgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccttcctcatccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttgcctcattctcaagcctcagacagtggttcaaagtttttttcttccatttcagGTGTCGTGA

in context:

CTGCAGGGCCCACTAGTGGAGCCGAGAGTAATTCATACAAAAGGACTCGCCCCTGCCTTGGGGAATCCCAGGGACCGTCGTTAAACTCCCACTAACGTAGAACCCAGAGATCGCTGCGTTCCCGCCCCCTCACCCGCCCGCTCTCGTCATCACTGAGGTGGAGAAGAGCATGCGTGAGGCTCCGGTTCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGACAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGgtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccatgcccctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcttgggcgctggggccgccgcgtgctaatctggtggcaccttcgcgcctgtctcgctgctttcgctaagtctctagccatttaaaatttttgataaccagctgcgacgctttttttctggcgagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaaactggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgcccgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccttcctcatccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttgcctcattctcaagcctcagacagtggttcaaagtttttttcttccatttcagGTGTCGTGAAAACTACCCCTAAAAGCCACC ATG GGG GGT TCT CAT CAT CAT CAT CAT CAT

This is a EF1a core promoter plus CMV enhancer (EF1a core promoter underlined; enhancer upstream):

ACATGTTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGAATTGGTTTGATCTGATTATAACTAGTGGAGAAGAGCATGCTTGAGGGCTGAGTGCCCCTCAGTGGGCAGAGAGCACATGGCCCACAGTCCCTGAGAAGTTGGGGGGAGGGGTGGGCAATTGAACTGGTGCCTAGAGAAGGTGGGGCTTGGGTAAACTGGGAAAGTGATGTGGTGTACTGGCTCCACCTTTTTCCCCAGGGTGGGGGAGAACCATATATAAGTGCAGTAGTCTCTGTGAACATTCGCTAGCAGATCT

 

 

 

Advertisements