AtTCTP Promotert2A new plant promoter. It is pretty small (0,3 kbp), but still yields 55% the expression levels of 35S. Nice for synbio applications.

From the paper: “Characterization of a small constitutive promoter from Arabidopsis translationally controlled tumor protein (AtTCTP) gene for plant transformation”.

Shown to work in Arabidopsis (dicot) and Grass (monocot).

Here a shot of the annotated file in snapgene: AtTCTP Promotert.jpg

CCCTGTTCAAAGCTATCATCGTCATTCTAGGGTTTTACACGAACAATCAGAAACAGAACGAGAAAGACGGAAGAGAAGAGAGGGAAATAGGATTTTATCCGACCCGAACACTATTTATACGTAGCCCAACACTCGAATCCCCACCCGTTGGACCAAACCCGGCTCATTAAGCGTCGGTTCAGATTTATTTCCTTTATTTAAAAAAAAGGAAAGGGTAAAAAATAGAAAATTGGAAACAGTTAAAGCCCAAAATTGTAATTTACCGAGAATTGTAAATTTACCTGAAAACCCTACGCTATAGTTTCGACTATAAATACCAAACTTAGGACCTCACTTCAGAATCCCCTCGTCGCTGCGTCTCTCTCCCGCAACCTTCGATTTTCGTTTATTCGCATCCATCGGAGAGAGAAAACAATCAATAAGCGACCATG

Advertisements