Prions are a scary thing. When we think of infectious dangers, we usually think of “life forms” such as bacteria or viruses or other things that look or behave somewhat alive.
But prions are just proteins that occur in the brain. Normally folded, they have their function. However, when they misfold, not only do they stop being useful in the brain, they also can actively misfold other prion proteins. This then leads to a cascade of damage that results in brain disease and death.
In order to understand the molecular mechanism (and to hopefully find a cure someday), we need to look at the protein. The paper “A naturally occurring variant of the human prion protein completely prevents prion disease” gives us the primer sequence to the human prion protein as follows:
“The 759-bp human PrP ORF was amplified by PCR […] using forward primer 5’- GTCGACCAGTCATTATGGCGAACCTT-3’ and reverse primer 5’-
CTCGAGAAGACCTTCCTCATCCCACT-3’.
Restriction sites SalI (GTCGAC) and Xho I (CTCGAG) (underlined) were introduced in the forward and reverse primers respectively for cloning.”
Blasting those primers one finds the mRNA, and aligning it to the human genome I got to the file “Homo sapiens chromosome 20, GRCh38.p14 Primary Assembly”. We only look at the ORF (coding site) that is translated into the prion protein, because the full transcript with its introns is huge.
We first go to: Human reference genome GRCh38.p14 ; Homo sapiens (human); Submitted by Genome Reference Consortium (February 2022); RefSeq: GCF_000001405.40
https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_000001405.40/
then we chose chromosome 20: https://www.ncbi.nlm.nih.gov/nuccore/NC_000020.11/
And we see that the whole prion protein coding site itself does not seem to be interrupted by any introns! There is an alternative coding site that is in a different frame, but no introns or anything.
This is the coding site of the prion protein: atggcgaaccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgcaagaagcgcccgaagcctggaggatggaacactgggggcagccgatacccggggcagggcagccctggaggcaaccgctacccacctcagggcggtggtggctgggggcagcctcatggtggtggctgggggcagcctcatggtggtggctgggggcagccccatggtggtggctggggacagcctcatggtggtggctggggtcaaggaggtggcacccacagtcagtggaacaagccgagtaagccaaaaaccaacatgaagcacatggctggtgctgcagcagctggggcagtggtggggggccttggcggctacatgctgggaagtgccatgagcaggcccatcatacatttcggcagtgactatgaggaccgttactatcgtgaaaacatgcaccgttaccccaaccaagtgtactacaggcccatggatgagtacagcaaccagaacaactttgtgcacgactgcgtcaatatcacaatcaagcagcacacggtcaccacaaccaccaagggggagaacttcaccgagaccgacgttaagatgatggagcgcgtggttgagcagatgtgtatcacccagtacgagagggaatctcaggcctattaccagagaggatcgagcatggtcctcttctcctctccacctgtgatcctcctgatctctttcctcatcttcctgatagtgggatga
And the alternative ORF: atggaacactgggggcagccgatacccggggcagggcagccctggaggcaaccgctacccacctcagggcggtggtggctgggggcagcctcatggtggtggctgggggcagcctcatggtggtggctgggggcagccccatggtggtggctggggacagcctcatggtggtggctggggtcaaggaggtggcacccacagtcagtggaacaagccgagtaa
diyspartanbiotech 